Skip to main content
Download PDF

Drp1 mitochondrial fission in astrocyte modulates behavior and neuroinflammation during morphine addiction

Journal of Neuroinflammation volume 22, Article number: 108 (2025) Cite this article

Abstract

Background

Mitochondrial dynamics in neurons accompanied by neuroinflammation has been proved as pivotal events during repeated morphine exposure, however, the relationship between mitochondrial dynamics and neuroinflammation still remains unknown.

Methods

This study was designed to investigate the potential role of astrocyte Drp1 in neuroinflammation during morphine addiction. Nucleus accumbens (NAc) tissues were collected for immunofluorescence, transmission electron microscopy (TEM) and quantitative real-time polymerase chain reaction (qRT-PCR) to detect the expression of pro-inflammatory cytokines and mitochondrial fission proteins. Morphine-induced conditioned place preference (CPP) and open field test (OFT) were used to determine the effects of Mdivi-1, a selective inhibitor of mitochondrial fission protein Drp1 in the rewarding properties of morphine. Astrocyte-specific knockdown experiments by an adeno-associated virus (AAV) vector containing shRNADrp1–EGFP infusion were performed to determine the effects of astrocyte Drp1 in NAc of mice with morphine treatment.

Results

In this study, we found that repeated morphine exposure induced mitochondrial fragmentation in neurons, astrocytes, and microglia in NAc, correlating with increased inflammatory markers and addictive behaviors. The application of Mdivi-1 effectively mitigated mitochondrial fragmentation and astrocyte-mediated neuroinflammation within the NAc, thereby alleviating morphine-induced addictive behaviors. Crucially, the astrocyte-specific knockdown of Drp1 in NAc significantly curtailed drug-seeking behavior and substantially reduced neuroinflammation.

Conclusions

Collectively, our findings suggest that alterations in mitochondrial dynamics, particularly within astrocytes, play an important role in regulating neuroinflammation associated with morphine addiction. This research offers novel insights into potential therapeutic strategies for addressing substance use disorder (SUD) by regulating mitochondrial dynamics within astrocyte.

Background

Opioid addiction has emerged as a significant socioeconomic and health issue, underscored by a notable increase in overdose-related fatalities [1,2,3]. Thus, it is imperative to investigate the molecular and functional mechanisms underlying opioid addiction to develop therapeutic substitutes. Chronic morphine usage has been shown to induce neuroinflammation within the central nervous system (CNS), which is linked to the enhancement of morphine-induced physical and psychological dependence [4]. Morphine-induced neuroinflammation is typically accompanied by microglial activation and the generation of inflammatory mediators such as cytokines, chemokines, and surface antigens [5]. Astrocytes, being the most abundant type of glial cells, are crucial for various modulatory and supportive functions throughout the CNS, including regulation of glutamate levels and neurometabolic homeostasis [6]. Although astrocytes are often less recognized for their immunoregulatory role compared to microglia, they also play a significant part in inflammatory signaling within the CNS and in the regulation of immune cell trafficking [7]. Our previous studies indicated that morphine-induced inflammation results from enhanced glycolysis in astrocytes, accompanied by the presence of abnormally fragmented mitochondria [8]. However, the specific regulatory mechanisms by which astrocytes contribute to morphine addiction, as well as the key molecular events involved, remain poorly understood.

Mitochondrial fragmentation results from an imbalance between mitochondrial fusion and fission, processes crucial for cellular metabolic regulation and response to inflammatory stimuli, and it plays a pivotal role in the development of neuroinflammation [9, 10]. Drp1, an essential regulator of mitochondrial fission, controls mitochondrial dynamics by balancing the processes of fission and fusion [11]. Research has shown that microglial activation occurs in the early stages of Alzheimer’s Disease (AD), along with elevated levels of Drp1 [12]. In Parkinson’s Disease (PD), neuroinflammation triggered by microglial activation has been closely associated with Drp1-mediated mitochondrial fission [13]. The activation of Drp1 has been identified as a pivotal signaling event leading to mitochondrial fission in astrocytes under inflammatory conditions [14]. Jake G. Hoekstra et al. demonstrated that Drp1 in astrocytes contributes to neuronal protection against excitotoxicity in PD [15]. Marlena Zysk et al. observed elevated levels of phosphorylated Drp1 in astrocytes exposed to amyloid-beta (Aβ), with this phosphorylated Drp1 co-localizing with lipid droplets [16]. The role of Drp1 has also been implicated in SUD. Elevated Drp1 levels in the D1 neurons are associated with shortened mitochondrial length, as well as changes in both cellular and behavioral plasticity during the withdrawal phase after chronic cocaine administration [17]. Drp1-mediated mitochondrial fission plays important roles in methamphetamine-induced neuronal programmed necrosis [18]. Recent findings by Malan and colleagues demonstrated that pharmacological inhibition of Drp1 using the mitochondrial fission inhibitor Mdivi-1 can attenuate morphine-induced oxidative stress in dopaminergic neurons in the ventral tegmental area (VTA), ameliorating the adverse effects of morphine withdrawal [19]. These studies suggest that abnormal mitochondrial fission plays a key role in the regulation of neuronal damage induced by drug abuse. However, the role of mitochondrial dynamics in neuroinflammation induced by SUD remains unclear, especially the participation of astrocytes.

In this study, we aimed to elucidate the role of mitochondrial dynamics in neurons, astrocytes, and microglia in the context of morphine addiction, with a specific focus on the critical regulatory function of mitochondrial fission in astrocytes during morphine-induced neuroinflammation and addictive behaviors.

Materials and methods

Subjects

Adult male C57BL/6J mice (5 to 8 weeks) were obtained from the Guangdong Medical Laboratory Animal Center (Guangdong, China). These mice were given free access to food and water and kept in a controlled setting with a 12-hour light/dark cycle. They were split into the experimental and control groups at random, and the researchers were blinded to the group assignments during the behavioral tests. All experimental procedures were examined and approved by the Institutional Animal Care and Use Committee of Hainan University (approval number: HNUAUCC-2021-00025).

Drugs and infusion procedures

Northeast Pharm (Shenyang, China) provided the morphine hydrochloride, which was administered once daily for four days in a row after being dissolved in sterile saline. Mice were given either morphine (10 mg/kg, i.p.) or a comparable amount of saline according to previous protocols [20]. Mice were administered Mdivi-1 (50 mg/kg, i.p.) (Cat# HY-15886, MedChem Express) or an equivalent volume of saline 45 min prior to morphine injection, as previously described [19].

Morphine-conditioned place preference (CPP) test

Place preference training was conducted in a custom-made two-chamber CPP apparatus (Jiliang, Shanghai, China). On habituation phase (day 1), mice were allowed to explore the apparatus freely for 30 min. To determine each mouse baseline place preference during the pre-test, the amount of time they spent in each chamber was noted on day 2. Mice exhibiting a significant initial preference for either side (defined as a > 70% difference) were not allowed to participate in the trial. During days 3–6 (conditioning phase), the animals underwent daily pairings consisting of two 30-minute sessions: the mice were kept in their preferred chamber for 30 min after receiving saline injection. After a minimum of 4 h, the same mice were placed in the non-preferred chamber for 30 min, followed by an injection of 10 mg/kg morphine. On consecutive days, the order for the injection was changed. During post-test (day 7), mice were once again permitted to freely roam the two-chamber for 30 min, as day 1 [21]. The preference was determined as the proportion of time spent in the chamber with morphine. The CPP score was calculated by subtracting the time spent in the morphine-paired side during the pre-test from the time spent in the same side during the post-test.

Surgery and intracranial injection

Mice were anesthetized with 4% isoflurane in the induction chamber. The isoflurane concentration was kept between 1% and 2% for the duration of the surgery after the initial induction. The skull was adjusted to ensure the bregma and lambda were aligned horizontally. A small craniotomy was created using a dental drill (RWD, Shenzhen, China), and injections were made using a glass microelectrode connected to a Nanoliter Injection Pump (RWD, Shenzhen, China), which delivered a consistent injection rate of 100 nL/min. The injection needle was not withdrawn until 10 min after the infusion was complete to allow adequate diffusion of the virus. The intended stereotaxic coordinates for the NAc were + 1.5 mm AP, ± 0.8 mm ML, − 4.3 mm DV. The viral injection volumes were as follows: 300 nL/site. For specific knockdown of astrocytic Drp1, a virus carrying Drp1-shRNA under a gfaABC1D promoter (AAV2/5-GfaABC1D-EGFP-shRNADrp1-WPRE) or a control virus (AAV2/5-GfaABC1D-EGFP-NC-WPRE), purchased from Obio Technology (Shanghai, China), was bilaterally injected into the NAc of mice. AAV expression was permitted for at least 2 weeks before the experiments; mice with an off-target placement of EGFP were not included in the analysis.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Mouse NAc tissue was used to extract total RNA by the Spin Column Animal Total RNA Purification Kit (Cat# B518651, Sangon Biotech), and cDNA synthesis was carried out with the PrimeScript RT Reagent Kit with gDNA (Cat# RR047B, TAKARA). TB Green Premix Ex Taq II (Cat# RR820A, TAKARA) was used for quantitative qRT-PCR, and the results were detected by qRT-PCR machines (Cat# qTOWER3, Analytik Jena). Sangon Biotech supplied the qRT-PCR primer sequences for mRNA quantification, which are as follows: Gapdh: 5’-CAACTCACTCAAGATTGTCAGCAA, 3’-GGCATGGACTGTGGTCATGA; Drp1: 5’- AGGTGGCCTTAACACTATTGACA, 3’- CAGTTTGCAGTCTAATTCGCAGA; Fis1: 5’-CCGGCTCAAGGAATATGAAA, 3’-ACAGCCAGTCCAATGAGTCC; Mff: 5’-AGTGTGATAATGCAAGTCCCAGA, 3’-GAGTGGACTGGATAAGGTCAAGA; TNFα: 5’-CCAGTGTGGGAAGCTGTCTT, 3’-AAGCAAAAGAGGAGGCA ACA; IL-1β: 5’-GGTCAAAGGTTTGGAAGCAG, 3’-TGTGAAATGCCACCTTTTGA. For analysis of qPCR data, the relative expression level was performed using the double delta CT method after determining the CT values for reference (Gapdh) and target genes (Drp1, Fis1, Mff, TNFα or IL-1β) in each sample sets.

Transmission electron microscopy

For electron microscopic observation, the NAc brain tissue was stored at room temperature for 2 h in glutaraldehyde fixative and then preserved at 4 °C. Images were captured using a transmission electron microscope (HT7800, Hitachi, Tokyo, Japan). During the imaging process, a skip-sectioning method was employed to obtain cells from diverse interfaces for statistical analysis. Simultaneously, a comparison of each acquired image was conducted to ensure the absence of duplication. Different cell types were identified following the method in previous research [22, 23]. For the analysis of mitochondria using electron microscopy, Fiji was utilized to quantitatively analyze the mitochondrial length (i.e., the length of the longest axis) of different cell types in the NAc. The average value of mitochondrial length measurements for at least 5 cells per sample in different groups was calculated (n = 4). These analyses were performed blinded to reduce bias.

Immunohistochemistry

Mice were anesthetized and transcardially perfused with phosphate-buffered saline (PBS) and 4% paraformaldehyde. The brains were then harvested and post-fixed overnight, followed by dehydration in a gradient sucrose solution (20 − 30%, w/v) for more than 48 h at 4 °C. Using a microtome (RWD FS800, Shenzhen, China), 40 μm coronal slices were produced. The slices were washed with PBS and then blocked with 5% Bovine Serum Albumin (Cat# SRE0096, Sigma) in PBS containing 0.3% Triton X-100 (PBST) for 2 h at room temperature. After the blocking buffer was removed, the sections were incubated with one or more of the following primary antibodies at 4 °C: rabbit anti-S100β (1:300, Abcam Cat#ab52642); goat anti-Iba1 (1:300, Abcam Cat#ab5076); mouse anti- TNFα (1:50, Abcam Cat# ab1793); mouse anti-Drp1 (1:50, Santa Cruz Biotechnology Cat#sc-271583); rabbit anti-Iba1 (1:500, Wako Cat# 019-19741) and rat anti-NeuN (1:500, Abcam Cat#ab279297). After samples had been washed in PBST buffer, they were treated for 1.5 h at RT with ≥ 1 of the following Alexa Fluor-conjugated secondary antibodies (as appropriate for the primary antibodies used in the previous incubation): Alexa Fluor 555 goat anti-rabbit IgG (1:500, Thermo Cat# A32732); Alexa Fluor 633 goat anti-mouse IgG (1:500, Thermo Cat# A-21052); Alexa Fluor 555 donkey anti-goat IgG (1:500, Thermo Cat# A-21432); Alexa Fluor 488 donkey anti-rabbit IgG (1:500, Abcam Cat# ab150073); Alexa Fluor 647 donkey anti-mouse IgG (1:500, Abcam Cat# ab150107); Alexa Fluor 555 goat anti-rat IgG (1:500, Invitrogen Cat# A-21434); Alexa Fluor 594 goat anti-rabbit IgG (1:500, Abcam Cat# ab150080) and Alexa Fluor 647 goat anti-mouse IgG (1:500, Abcam Cat# ab150115). Before sections were sealed with mounting medium (ProLong™ Diamond, invitrogen), they were counterstained with DAPI. Using a slide scanner (VS200, Olympus, Japan) or confocal laser-scanning microscope (FV3000, Olympus, Japan), microscopic images were taken.

Image analysis

Brain sections were imaged with Olympus FV3000 or Olympus VS200 with 10x or 20x objectives, or a 40x objective at identical settings for all conditions. For each mouse, brain sections were analyzed bilaterally, and then averaged across sections. In each experimental condition, two coronal sections of each mouse were analyzed from a specified number of animals. The average values of 2 to 4 images of each mouse were used for quantification. Fluorescence colocalization was quantitatively analyzed using Fiji Plugins-JACoP. The relative TNFα fluorescence intensity in S100β or Iba-1 cells refer to the proportion of astrocytes or microglial that co-localize with TNFα relative to the total astrocyte or microglial population.

Statistical analysis

All data is displayed as mean ± SEM. Prism 9.5.1 was used for statistical analysis. Statistical significance was determined as described in the figure legends, with two-tailed unpaired Student’s t-test for comparisons between two groups, and one-way or two-way ANOVA followed by Sidak’s multiple comparison test for comparisons among multiple groups. A significance level of p < 0.05 was considered statistically significant.

Results

Repeated morphine administration induces neuroinflammation and promotes mitochondrial fragmentation in the NAc

To investigate the impact of repeated morphine administration on mitochondrial function in the NAc, we employed a well-established morphine-CPP protocol, as described by Tzschentke [24]. In this protocol, mice were given daily intraperitoneal (i.p.) injections of saline, followed by a 30-minute confinement to one side of the CPP chamber in the morning. Four hours later, the mice received an i.p. injection of morphine (10 mg/kg) and were confined to the opposite side of the chamber for 30 min (Figs. 1A and 2A, and 4A). The results showed a significant increase in CPP scores in morphine-treated mice compared to controls, indicating a marked preference for the morphine-paired environment (Fig. 1B-D). Additionally, by qRT-PCR, we observed a marked upregulation of the pro-inflammatory cytokine TNFα and IL-1β in the NAc of mice exposed to repeated morphine administration (Fig. 1F and G).

Fig. 1
figure 1

Repeated morphine administration induced neuroinflammation and promotes mitochondrial fragmentation in the NAc of mice. (A-B) Experimental scheme of the behavioral tests for saline and morphine groups. (C) Representative tracks of mice in CPP experiment on pre-test and post-test. (D) CPP score (post-test minus pre-test, 1800 s) (n = 12 mice in each group). (E) Schematic diagram for qRT-PCR and electron microscope data collection of the CPP experimental mice. (F-J) qRT-PCR analysis of TNFα, IL-1β, Drp1, Fis1 and Mff expression in NAc (n = 4 mice in each group). (K) Representative TEM micrographs of mitochondria morphology in NAc neurons, astrocytes and microglia from treated mice (scale bar, 500 nm). (L) Quantification of mitochondrial length in NAc measured by TEM micrographs (n = 4 mice in each group). Data are presented as mean ± SEM; D, F-J, L: p-values were calculated by unpaired two-tailed Student’s t tests. ns, not significant; *P < 0.05, **P < 0.01, ****P < 0.0001

Full size image
Fig. 2
figure 2

Inhibiting mitochondrial fission with Mdivi-1 reduces morphine-induced behavior and mitochondria morphological damage. (A-B) Experimental scheme of the behavioral tests for saline and morphine groups treated with vehicle or Mdivi-1. (C) The preference of the CPP experimental mice during pre-test and post-test. (n = 11 mice in each group). (D) Quantification of the morphine CPP score in the mice injected with Mdivi-1 or vehicle. (n = 11 mice in each group). (E-I) qRT-PCR analysis of TNFα, IL-1β, Drp1, Fis1 and Mff expression in NAc (n = 4 mice in each group). (J) Representative electron microscope images of the mitochondria morphology in NAc neurons, astrocytes and microglia from treated mice (scale bar, 500 nm). (K-M) Cumulative frequency distribution graph and quantification of mitochondrial length in NAc neurons (K), astrocytes (L) and microglia (M) (n = 4 mice in each group). Data are presented as mean ± SEM; C, D: p-values were calculated by two-way ANOVA with Sidak’s multiple comparison. E-I, K-M: p-values were calculated by one-way ANOVA with Sidak’s multiple comparison. ns, not significant; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Full size image
Fig. 3
figure 3

Mdivi-1 mitigates morphine-induced inflammation associated with astrocytes. (A) Representative immunostaining for TNFα (red), astrocytic marker S100β (green) and microglia marker Iba-1 (cyan) in the NAc under different conditions. DAPI stains nucleus (blue). (Scale bars, 20 μm–10 μm). (B) Intensity traces from the TNFα (red) and S100β (green) enlarged image are plotted. (C) Intensity traces from the TNFα (red) and Iba-1 (cyan) enlarged image are plotted. (D-E) Quantification of relative expression of TNFα in astrocytes (D) and microglia (E) (n = 4 mice in each group). D-E: p-values were calculated by one-way ANOVA with Sidak’s multiple comparison. ns, not significant; *P < 0.05

Full size image
Fig. 4
figure 4

Deficit of Drp1 in NAc astrocytes inhibits repeated morphine-induced CPP and mitochondrial fragmentation. (A) Experimental timeline for (B-E). (B) Schematic diagram of the site (left) and fluorescent images (right) of the injected virus. Representative immunostaining for Drp1 (red), astrocytic marker S100β (cyan) and AAV (green) in the NAc under different conditions. DAPI stains nucleus (blue). (Scale bar, 50 μm). (C) The preference of the CPP experimental mice during pre-test and post-test (n = 12 mice in each group). (D) Quantification of the morphine CPP score in the mice injected with AAV-GFP or AAV- shDrp1 (n = 12 mice in each group). (E) Body weight changes of treated mice (n = 12 mice in each group). (F) Representative electron microscope images of the mitochondria morphology in NAc astrocytes from treated mice (scale bar, 500 nm). (G) Cumulative frequency distribution graph of mitochondrial length in NAc astrocytes measured by TEM micrographs (n = 4 mice in each group). (H) Quantification of mitochondrial length in NAc astrocytes (n = 4 mice in each group). Data are presented as mean ± SEM; C-E, H: p-values were calculated by two-way ANOVA with Sidak’s multiple comparison. ns, not significant, **p < 0.01, ***P < 0.001

Full size image

Studies have shown that the mitochondrial structure is highly dynamic and is mainly regulated by mitochondrial fission proteins [25]. To assess the effect of long-term morphine exposure on mitochondrial dynamics, we examined the expression of factors linked to mitochondrial fission in the NAc by qRT-PCR, a significant upregulation of Drp1 and Fis1 mRNA was shown in morphine-treated mice, while Mff mRNA remained unchanged (Fig. 1H-J). To further clear the mitochondrial morphology in cells, TEM was used. TEM pictures revealed that mitochondria in all the neurons, astrocytes, and microglia, were more fragmented and smaller in morphine-treated group (Fig. 1K). Quantitative analysis of mitochondrial morphology in neurons, astrocytes, and microglia within the NAc showed a decreased proportion of longer mitochondria, with a shift toward shorter mitochondria in the morphine-treated group, as indicated by cumulative frequency distribution plots (Fig. 1L). Consistent with these observations, the overall mitochondrial length was significantly reduced following morphine treatment (Fig. 1L). These results indicated that repeated morphine exposure caused mitochondrial morphological and structural abnormalities in all the neurons, astrocytes, and microglia, and induces neuroinflammation in the NAc.

Mdivi-1 alleviates morphine-induced addictive behavior and mitochondrial fragmentation

Recent studies suggest that modulating mitochondrial dynamics through small molecules or genetic interventions could offer therapeutic potential for various brain diseases. In this study, we investigated the direct impact of targeting mitochondrial fragmentation on repeated morphine treatment by administering Mdivi-1, a selective inhibitor of Drp1 that effectively blocks mitochondrial fission [26, 27]. Morphine-treated mice exhibited significantly higher CPP scores compared to control mice; however, Mdivi-1 treatment markedly reduced CPP scores (Fig. 2B-D). Notably, Mdivi-1 administration did not significantly impact anxiety levels or locomotor activity (Additional file 1: Fig. S1A-S1C). We also observed that TNFα and IL-1β mRNA levels through qRT-PCR were significantly elevated in morphine-treated mice; however, this increase was attenuated by Mdivi-1, suggesting its potential role in reducing neuroinflammation (Fig. 2E and F). These results suggested that Mdivi-1 mitigated the reinforcing effects of morphine on neuroinflammation and CPP scores.

To explore the impact of Mdivi-1 on mitochondrial dynamics, we examined the expression of genes involved in mitochondrial fission. qRT-PCR analysis revealed that, consistent with previous findings, the mRNA expressions of Drp1 and Fis1 were significantly elevated in morphine-treated mice. However, there was no notable change in these fission-related molecules following the administration of Mdivi-1 (Fig. 2G-I). Concurrently, the ultrastructure of mitochondria in the NAc was analyzed using TEM. Consistent with our previous findings, repeated morphine administration resulted in an increase of shorter mitochondria in neurons, astrocytes, and microglia within the NAc (Fig. 2J). However, the mitochondrial length within neurons and astrocytes were protected with Mdivi-1 (Fig. 2K and L). Interestingly, compared to the morphine treatment group, Mdivi-1 intervention did not significantly alter the overall mitochondrial length within microglial cells (Fig. 2M). Collectively, these findings demonstrate that Mdivi-1 effectively mitigates morphine-induced mitochondrial morphological disruptions in neurons and astrocytes in the NAc.

Mdivi-1 mitigates morphine-induced neuroinflammation mediated by astrocyte

To investigate the impact of Mdivi-1 on repeated morphine-induced neuroinflammation, we assessed the expression of pro-inflammatory cytokine TNFα in astrocytes and microglia within the NAc using immunostaining. The levels of TNFα were significantly elevated following morphine treatment; however, they exhibited a marked reduction after administration of Mdivi-1 (Fig. 3A). Double-labeled fluorescence microscopy revealed that TNFα was predominantly localized in both astrocytes and microglia. Notably, TNFα levels in S100β+ astrocytes within the NAc were significantly increased following repeated morphine exposure, while these levels were substantially diminished after Mdivi-1 treatment (Fig. 3A). Conversely, the localization patterns of microglia and TNFα fluorescence signals displayed an inverse relationship. Further colocalization analysis conducted on enlarged images using Fiji indicated that after morphine exposure, the fluorescence signal for TNFα was primarily co-localized with astrocytes rather than with microglia (Fig. 3B and D). In contrast, subsequent to Mdivi-1 administration, there was a decrease in co-localization between TNFα and astrocytes, while co-localization with microglia markedly increased (Fig. 3C and E). These findings suggest that neuroinflammation induced by repeated morphine exposure is predominantly associated with astrocytic activation and that Mdivi-1 effectively mitigates this process.

Deficit of Drp1 in NAc astrocytes alleviates morphine induced-CPP and mitochondrial fragmentation

The aforementioned data suggest that Mdivi-1 effectively inhibits morphine-induced addictive behaviors by targeting Drp1-mediated mitochondrial fragmentation and alleviating astrocyte-mediated neuroinflammation. Our previous studies have demonstrated that mitochondrial fragmentation in astrocytes mediates morphine-like behavior [8]. Based on these findings, we hypothesize that direct intervention mitochondrial fragmentation in astrocytes may alleviate morphine-induced neuroinflammation and addictive behaviors. To test this hypothesis, we specifically knocked down Drp1 in astrocytes in the NAc of 5-week-old wild-type male C57BL/6J mice through bilateral injection of AAV-GfaABC1D-shDrp1-EGFP or AAV-GfaABC1D-EGFP. Immunofluorescence imaging conducted three weeks post-injection confirmed the expression of AAV-GfaABC1D-shDrp1-EGFP in astrocytes and successful knockdown of Drp1 expression (Fig. 4B; Additional file 1: Fig. S2A; Additional file 1: Fig. S3A-B).

Subsequently, we investigated the effects of specific Drp1 knockdown in astrocytes on morphine-induced CPP. The findings revealed a significant increase in CPP scores in the AAV-CON group following repeated morphine exposure (Fig. 4C). In contrast, the CPP score of shDrp1 mice exhibited no significant change following morphine injection compared to saline injection, suggesting that the targeted knockdown of Drp1 in astrocytes may mitigate morphine induced addictive behaviors (Fig. 4D). Furthermore, while AAV-CON mice experienced significant weight loss after repeated morphine exposure, no significant changes in body weight were observed in mice treated with shRNA-Drp1 (Fig. 4E). Meanwhile, we also observed that shDrp1 mice did not significantly impact anxiety levels or locomotor activity compared with AAV-CON mice (Additional file 1: Fig. S2B-S2D). These results strongly suggest that Drp1 knockdown in NAc astrocytes attenuates morphine-induced addictive behavior.

To elucidate the impact of astrocyte-specific Drp1 knockdown on mitochondrial dynamics, we examined the mitochondrial morphology of astrocytes in NAc via TEM. As anticipated, following shDrp1 treatment, there was a significant increase in mitochondrial length within astrocytes (Fig. 4F). Additionally, in accordance with previous findings, repeated administration of morphine resulted in significant shortening of mitochondrial length. Conversely, following shDrp1 treatment, a notable increase in mitochondrial length was observed in astrocytes (Fig. 4G and H). Notably, in the morphine-treated group, the downregulation of Drp1 in astrocytes resulted in a marked elongation of neuronal mitochondria. In contrast, no significant changes were observed in microglial mitochondria (Additional File 1: Fig. S3C-D). These data demonstrate that specific knockdown of Drp1 in astrocytes can alleviate morphine-induced mitochondrial fragmentation.

Depletion of Drp1 in astrocytes attenuates morphine-induced neuroinflammation

To evaluate whether the specific Drp1 knockdown in astrocytes could alleviate morphine-induced neuroinflammation, we conducted an analysis of the expression levels of the TNFα and IL-1β. The results indicated a significant reduction of the TNFα and IL-1β mRNA levels in shDrp1 mice under repeated morphine administration (Fig. 5B and C). Immunostaining further confirmed that TNFα expression was markedly elevated in morphine-treated mice and this increase was notably suppressed by the absence of Drp1 (Fig. 5D). Next, the morphological alterations of NAc microglia were examined. The findings demonstrated that morphine induced an activated microglial phenotype that was typified by a decrease in the process length and branch count. On the other hand, the microglia in the group that received shDrp1 treatment resembled the resting phenotype in terms of shape (Fig. 5E and F). These results strongly imply that Drp1 is essential for controlling the neuroinflammation caused by morphine in NAc astrocytes.

Fig. 5
figure 5

Astrocytes Drp1 knockdown alleviate morphine-induced neuroinflammation. (A) Representative immunostaining for TNFα (red), AAV (green) and microglia marker Iba-1 (cyan) in the NAc under different conditions. DAPI stains nucleus (blue). The white cells represent the binarized morphology of Iba-1 enlarged image. (Scale bars, 20 μm–10 μm). (B-C) qRT-PCR analysis of TNFα and IL-1β expression in NAc (n = 4 mice in each group). (D) Quantification of TNFα fluorescence intensity in NAc under different conditions (n = 4 mice in each group). (E-F) Quantification of microglia branch number/cell (E) and branch length/cell (F) in NAc according to Iba1 fluorescent (n = 4 mice in each group). Data are presented as mean ± SEM; B-F: p-values were calculated by two-way ANOVA with Sidak’s multiple comparison. ns, not significant, *P < 0.05, **p < 0.01

Full size image

Discussion

This study provides evidence that mitochondrial dynamics, particularly mitochondrial fission in astrocytes, is involved in the development of morphine addiction. Our findings suggest that repeated morphine administration enhances mitochondrial fragmentation and induces neuroinflammation in the NAc, which can be blocked by Mdivi-1 administration. Notably, the knockdown of Drp1 in astrocytes effectively recovers compromised mitochondrial activity, reduces morphine-induced neuroinflammation, and diminishes addictive behaviors.

Mitochondrial dynamics are essential for energy generation, neurotransmitter release, and calcium homeostasis. Dysregulation of mitochondrial dynamics has been implicated in neuropsychiatric disorders, including anxiety, Alzheimer’s disease and substance use disorders [17, 28, 29]. In this study, under repeated morphine treatment, neurons, astrocytes, and microglia within the NAc exhibited pronounced mitochondrial dysfunction and fragmentation. Concurrently, the PCR data indicated that under the morphine treatment condition, the mRNA levels of the mitochondrial fission-related genes Drp1 and Fis1 were substantially up-regulated (Fig. 1H and I). Drp1, serving as a crucial effector protein directly implicated in the mitochondrial fission process, has emerged as a prospective therapeutic target for a variety of brain disorders. Blockade of mitochondrial fission in D1 neurons, either systemically or within the NAc using Mdivi-1, reduces cocaine place preference, prevents locomotor sensitization and seeking behavior after self-administration of cocaine [17]. Administration of Mdivi-1 alleviated mitochondrial fragmentation and the maladaptive changes in neuronal plasticity within these dopaminergic ensembles, which were also associated with a reduction in the development of opioid withdrawal following repeated morphine exposure [19]. Here, we also found that Mdivi-1 significantly alleviates mitochondrial breakage in neurons and astrocytes in NAc, thereby reducing morphine-induced neuroinflammation and addictive behaviors. Furthermore, our study achieved comparable experimental outcomes by specifically knocking down Drp1 gene expression in astrocytes. In summary, the results of this study strongly suggest that Drp1-mediated mitochondrial dynamic dysregulation plays a pivotal role in maladaptive cellular and behavioral responses induced by SUD.

Astrocytes are the most abundant glial cells and have a wide range of homeostatic functions in the CNS. These functions include providing support for other CNS-resident cells, such as neurons, regulating synaptic function, and modulating CNS inflammation [30, 31]. Recent study showed that bidirectional communication between astrocytes and microglia modulates CNS inflammation through the secretion of multiple cytokines and inflammatory mediators [32, 33]. Kiss and colleagues reported that astrocyte-produced IL-3 induces disease-promoting responses in microglia and monocytes, contributing to the pathology of multiple sclerosis [34, 35]. Conversely, Jo et al. reported that astrocytes can suppress microglial activation in the context of systemic lipopolysaccharide-driven CNS inflammation through the production of orosomucoid-2 [36]. Our prior studies have demonstrated that morphine-induced neuroinflammation critically involves astrocytes, where morphine exposure leads to metabolic dysregulation and the activation of microglia, contributing to neuronal damage [8]. Our results further confirm that the neuroinflammation ensuing from repeated morphine exposure is intimately intertwined with both the activation of astrocytes and the reciprocal communication between astrocytes and microglia. It has been reported that Drp1 in astrocytes is activated when stimulated by inflammation, leading to mitochondrial division [14]. Mitochondrial fission activates the NF-κB signaling pathway by increasing intracellular oxidative stress levels [37]. In astrocytes, NF-κB participates in complex inflammatory loops regulating production and release of proinflammatory cytokines, such as IL-1β, TNFα, and inducible NO synthase (iNOS) [38, 39]. The data reveal that, under the influence of morphine stimulation, the fluorescence signal of TNFα predominantly co-localizes with astrocytes. However, upon the administration of Mdivi-1, a pronounced augmentation in the co-localization of TNFα with microglia is discernible (Fig. 3).

Subsequently, we embarked on a mechanistic exploration by selectively ablating the Drp1 gene within astrocytes. The result indicates that the knockdown of Drp1 specific to astrocytes is capable of significantly attenuating morphine addiction-related behaviors and curtailing the expression of inflammatory factors within the NAc. Using TEM, we observed that astrocytes with Drp1 knockdown exhibited significantly elongated mitochondrial structures and a more normalized morphology under repeated morphine exposure, suggesting restored mitochondrial function and enhanced cellular activity. Notably, this improvement in mitochondrial morphology also caused a change in microglial activation status, and we observed that NAc microglia in the astroglia-specific Drp1 knockdown group exhibited a similar resting phenotype to those in the control group (Fig. 5). These findings highlight the complexity of astroglia-microglia interactions and suggest the important role of cytokines and inflammatory mediators in astrocyte control of microglia. Concurrently, we observed that Mdivi-1 and Drp1 knockdown had distinct effects on microglia, attributable to their different targets and action mechanisms. Mdivi-1 impacts energy metabolism in various cell models and directly modulates microglia function via interactions with intracellular components. In contrast, Drp1 knockdown targets the Drp1 gene in astrocytes, indirectly influencing microglia by altering astrocyte activity. This direct-indirect mechanism difference explains the observed effect disparities. Overall, our results highlighting the critical role of astrocytes in maintaining neuroimmune balance and the involvement of Drp1 in the regulation of astrocyte mitochondrial dynamics during SUD.

Despite these advancements, there remains a significant gap in our comprehensive understanding of the intricate relationships between astrocyte dysfunction and mitochondrial dynamics during morphine addiction. While our study indicates that Drp1-mediated mitochondrial disruption in astrocytes is implicated in the regulation of morphine-dependent behavior, it remains inconclusive whether morphine directly acts on astrocytes to increase Drp1 and promote mitochondrial division or whether its effects are indirect. Woojin Won et al. reported that astrocytes in the NAc express µ-opioid receptors [40], and Michelle Corkrum et al. demonstrated that activation of these receptors increases cytosolic calcium levels in astrocytes and stimulates the release of glial glutamate, thereby influencing neuronal NMDA receptors [41]. Although some studies have shown that morphine treatment of purified mouse astrocytes in vitro leads to long-term effects through opioid receptor activation, resulting in increased intracellular calcium concentration and premature morphologic differentiation [42, 43], there is currently no direct evidence that morphine can directly increase Drp1 and promote mitochondrial division. In conclusion, the mechanism by which morphine affects Drp1 in astrocytes remains unclear, and further research is necessary to elucidate this relationship.

Conclusions

In sum, our work demonstrates that modifications in mitochondrial dynamics within NAc astrocytes are significantly correlated with morphine-induced neuroinflammation. This alteration is pivotal in the modulation of morphine addictive behaviors, suggesting a potential therapeutic strategy aimed at restoring mitochondrial homeostasis in opioid use disorders.

Data availability

No datasets were generated or analysed during the current study.

Abbreviations

SUD:

Substance use disorder

CNS:

Central nervous system

NAc:

Nucleus accumbens

AD:

Alzheimer’s Disease

PD:

Parkinson’s Disease

VTA:

Ventral tegmental area

CPP:

Conditioned place preference

OFT:

Open field test

qRT-PCR:

Quantitative real-time polymerase chain reaction

TEM:

Transmission electron microscopy

PBS:

Phosphate-buffered saline

TNFα:

Tumor necrosis factorα

IL-1β:

Interleukin (IL)-1β

Drp1:

Dynamin-related protein 1

Fis1:

Mitochondrial fission protein 1

Mff:

Mitochondrial fission factor

Mdivi-1:

Mitochondrial division inhibitor 1

AAV:

Adeno-associated virus

References

  1. Volkow ND, Michaelides M, Baler R. The neuroscience of drug reward and addiction. Physiol Rev. 2019;99(4):2115–40.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Mitra S. Socioeconomic marginalization and overdose: implications for upstream approaches for overdose prevention during a prolonged public health emergency. University of British Columbia; 2022.

  3. Damiescu R, Banerjee M, Lee DYW, Paul NW, Efferth T. Health(care) in the crisis: reflections in science and society on opioid addiction. Int J Environ Res Public Health. 2021;18(1):341.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Wang X, Loram LC, Ramos K, de Jesus AJ, Thomas J, Cheng K, Reddy A, Somogyi AA, Hutchinson MR, Watkins LR, et al. Morphine activates neuroinflammation in a manner parallel to endotoxin. Proc Natl Acad Sci U S A. 2012;109(16):6325–30.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. DeLeo JA, Tanga FY, Tawfik VL. Neuroimmune activation and neuroinflammation in chronic pain and opioid tolerance/hyperalgesia. Neuroscientist. 2004;10(1):40–52.

    Article  CAS  PubMed  Google Scholar 

  6. Sofroniew MV. Molecular dissection of reactive astrogliosis and glial Scar formation. Trends Neurosci. 2009;32(12):638–47.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Lacagnina MJ, Rivera PD, Bilbo SD. Glial and neuroimmune mechanisms as critical modulators of drug use and abuse. Neuropsychopharmacology: Official Publication Am Coll Neuropsychopharmacol. 2017;42(1):156–77.

    Article  CAS  Google Scholar 

  8. Rao J, Sun W, Wang X, Li J, Zhang Z, Zhou F. A novel role for astrocytic fragmented mitochondria in regulating morphine addiction. Brain Behav Immun. 2023;113:328–39.

    Article  CAS  PubMed  Google Scholar 

  9. Westermann B. Mitochondrial fusion and fission in cell life and death. Nat Rev Mol Cell Biol. 2010;11(12):872–84.

    Article  CAS  PubMed  Google Scholar 

  10. Youle RJ, van der Bliek AM. Mitochondrial fission, fusion, and stress. Science. 2012;337(6098):1062–5.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Chang CR, Blackstone C. Dynamic regulation of mitochondrial fission through modification of the dynamin-related protein Drp1. Ann N Y Acad Sci. 2010;1201(1):34–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Li Y, Xia X, Wang Y, Zheng JC. Mitochondrial dysfunction in microglia: a novel perspective for pathogenesis of Alzheimer’s disease. J Neuroinflammation. 2022;19(1):248.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Xu L, Hao LP, Yu J, Cheng SY, Li F, Ding SM, Zhang R. Curcumin protects against rotenone-induced Parkinson’s disease in mice by inhibiting microglial NLRP3 inflammasome activation and alleviating mitochondrial dysfunction. Heliyon. 2023;9(5):e16195.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Motori E, Puyal J, Toni N, Ghanem A, Angeloni C, Malaguti M, Cantelli-Forti G, Berninger B, Conzelmann KK, Gotz M, et al. Inflammation-induced alteration of astrocyte mitochondrial dynamics requires autophagy for mitochondrial network maintenance. Cell Metabol. 2013;18(6):844–59.

    Article  CAS  Google Scholar 

  15. Hoekstra JG, Cook TJ, Stewart T, Mattison H, Dreisbach MT, Hoffer ZS, Zhang J. Astrocytic dynamin-like protein 1 regulates neuronal protection against excitotoxicity in Parkinson disease. Am J Pathol. 2015;185(2):536–49.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Zysk M, Beretta C, Naia L, Dakhel A, Pavenius L, Brismar H, Lindskog M, Ankarcrona M, Erlandsson A. Amyloid-beta accumulation in human astrocytes induces mitochondrial disruption and changed energy metabolism. J Neuroinflammation. 2023;20(1):43.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Chandra R, Engeln M, Schiefer C, Patton MH, Martin JA, Werner CT, Riggs LM, Francis TC, McGlincy M, Evans B, et al. Drp1 mitochondrial fission in D1 neurons mediates behavioral and cellular plasticity during early cocaine abstinence. Neuron. 2017;96(6):1327–e13411326.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Zhao X, Lu J, Chen X, Gao Z, Zhang C, Chen C, Qiao D, Wang H. Methamphetamine exposure induces neuronal programmed necrosis by activating the receptor-interacting protein kinase 3 -related signalling pathway. FASEB Journal: Official Publication Federation Am Soc Experimental Biology. 2021;35(5):e21561.

    Article  CAS  Google Scholar 

  19. Jiang C, Huang H, Yang X, Le Q, Liu X, Ma L, Wang F. Targeting mitochondrial dynamics of morphine-responsive dopaminergic neurons ameliorates opiate withdrawal. J Clin Investig 2024, 134(5).

  20. Kemény LV, Robinson KC, Hermann AL, Walker DM, Regan S, Yew YW, Lai YC, Theodosakis N, Rivera PD, Ding W et al. Vitamin D deficiency exacerbates UV/endorphin and opioid addiction. Sci Adv 2021, 7(24).

  21. Lin R, Liang J, Wang R, Yan T, Zhou Y, Liu Y, Feng Q, Sun F, Li Y, Li A, et al. The Raphe dopamine system controls the expression of incentive memory. Neuron. 2020;106(3):498–e514498.

    Article  CAS  PubMed  Google Scholar 

  22. Cragg B. Ultrastructural features of human cerebral cortex. J Anat. 1976;121(Pt 2):331.

    CAS  PubMed  PubMed Central  Google Scholar 

  23. Garcia-Cabezas MA, John YJ, Barbas H, Zikopoulos B. Distinction of neurons, glia and endothelial cells in the cerebral cortex: an algorithm based on cytological features. Front Neuroanat. 2016;10:107.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Tzschentke TM. Measuring reward with the conditioned place preference (CPP) paradigm: update of the last decade. Addict Biol. 2007;12(3–4):227–462.

    Article  CAS  PubMed  Google Scholar 

  25. Kleele T, Rey T, Winter J, Zaganelli S, Mahecic D, Perreten Lambert H, Ruberto FP, Nemir M, Wai T, Pedrazzini T, et al. Distinct fission signatures predict mitochondrial degradation or biogenesis. Nature. 2021;593(7859):435–9.

    Article  CAS  PubMed  Google Scholar 

  26. Kim H, Lee JY, Park KJ, Kim WH, Roh GS. A mitochondrial division inhibitor, Mdivi-1, inhibits mitochondrial fragmentation and attenuates Kainic acid-induced hippocampal cell death. BMC Neurosci. 2016;17(1):33.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Cassidy-Stone A, Chipuk JE, Ingerman E, Song C, Yoo C, Kuwana T, Kurth MJ, Shaw JT, Hinshaw JE, Green DR, et al. Chemical Inhibition of the mitochondrial division dynamin reveals its role in Bax/Bak-dependent mitochondrial outer membrane permeabilization. Dev Cell. 2008;14(2):193–204.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Hollis F, van der Kooij MA, Zanoletti O, Lozano L, Cantó C, Sandi C. Mitochondrial function in the brain links anxiety with social subordination. Proc Natl Acad Sci U S A. 2015;112(50):15486–91.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Mary A, Eysert F, Checler F, Chami M. Mitophagy in Alzheimer’s disease: molecular defects and therapeutic approaches. Mol Psychiatry. 2023;28(1):202–16.

    Article  CAS  PubMed  Google Scholar 

  30. Giovannoni F, Quintana FJ. The role of astrocytes in CNS inflammation. Trends Immunol. 2020;41(9):805–19.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Lee HG, Wheeler MA, Quintana FJ. Function and therapeutic value of astrocytes in neurological diseases. Nat Rev Drug Discov. 2022;21(5):339–58.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Linnerbauer M, Wheeler MA, Quintana FJ. Astrocyte crosstalk in CNS inflammation. Neuron. 2020;108(4):608–22.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Lee HG, Lee JH, Flausino LE, Quintana FJ. Neuroinflammation: an astrocyte perspective. Sci Transl Med. 2023;15(721):eadi7828.

    Article  CAS  PubMed  Google Scholar 

  34. Kiss MG, Mindur JE, Yates AG, Lee D, Fullard JF, Anzai A, Poller WC, Christie KA, Iwamoto Y, Roudko V, et al. Interleukin-3 coordinates glial-peripheral immune crosstalk to incite multiple sclerosis. Immunity. 2023;56(7):1502–e15141508.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. McAlpine CS, Park J, Griciuc A, Kim E, Choi SH, Iwamoto Y, Kiss MG, Christie KA, Vinegoni C, Poller WC, et al. Astrocytic interleukin-3 programs microglia and limits Alzheimer’s disease. Nature. 2021;595(7869):701–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Jo M, Kim JH, Song GJ, Seo M, Hwang EM, Suk K. Astrocytic Orosomucoid-2 modulates microglial activation and neuroinflammation. J Neurosci. 2017;37(11):2878–94.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Rahman MH, Suk K. Mitochondrial dynamics and bioenergetic alteration during inflammatory activation of astrocytes. Front Aging Neurosci. 2020;12:614410.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Jong Huat T, Camats-Perna J, Newcombe EA, Onraet T, Campbell D, Sucic JT, Martini A, Forner S, Mirzaei M, Poon W, et al. The impact of astrocytic NF-kappaB on healthy and Alzheimer’s disease brains. Sci Rep. 2024;14(1):14305.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Colombo E, Farina C. Astrocytes: key regulators of neuroinflammation. Trends Immunol. 2016;37(9):608–20.

    Article  CAS  PubMed  Google Scholar 

  40. Won W, Kim D, Shin E, Lee CJ. Mapping astrocytic and neuronal mu-opioid receptor expression in various brain regions using MOR-mCherry reporter mouse. Exp Neurobiol. 2023;32(6):395–409.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Corkrum M, Rothwell PE, Thomas MJ, Kofuji P, Araque A. Opioid-Mediated Astrocyte-Neuron signaling in the nucleus accumbens. Cells 2019, 8(6).

  42. Hauser KF, Stiene-Martin A, Mattson MP, Elde RP, Ryan SE, Godleske CC. mu-Opioid receptor-induced Ca2 + mobilization and astroglial development: morphine inhibits DNA synthesis and stimulates cellular hypertrophy through a Ca(2+)-dependent mechanism. Brain Res. 1996;720(1–2):191–203.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Stiene-Martin A, Gurwell JA, Hauser KF. Morphine alters astrocyte growth in primary cultures of mouse glial cells: evidence for a direct effect of opiates on neural maturation. Brain Res Dev Brain Res. 1991;60(1):1–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This study was funded in part by the STI2030-Major Projects (2022ZD0212200), Hainan Province Key Area R&D Program (KJRC2023C30), and Project of Collaborative Innovation Center of One Health (XTCX2022JKB02).

Author information

Authors and Affiliations

  1. State Key Laboratory of Digital Medical Engineering, School of Biomedical Engineering, Hainan University, Sanya, 572025, China

    Xiaotong Gu, Wenjing Chen, Zixin Li, Xinran Wang, Qianying Su & Feifan Zhou

  2. Key Laboratory of Biomedical Engineering of Hainan Province, One Health Institute, Hainan University, Haikou, 570100, China

    Feifan Zhou

Authors
  1. Xiaotong Gu
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Wenjing Chen
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Zixin Li
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Xinran Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Qianying Su
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Feifan Zhou
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

F. Zhou conceived and designed the experiments. X. Gu, W. Chen, Z. Li, X. Wang and Q. Su performed the experiments and analyzed the data. X. Gu and F. Zhou wrote the manuscript. All the authors read and approved the manuscript.

Corresponding author

Correspondence to Feifan Zhou.

Ethics declarations

Ethics approval and consent to participate

All experimental procedures were examined and approved by the Institutional Animal Care and Use Committee of Hainan University (approval number: HNUAUCC-2021-00025).

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Gu, X., Chen, W., Li, Z. et al. Drp1 mitochondrial fission in astrocyte modulates behavior and neuroinflammation during morphine addiction. J Neuroinflammation 22, 108 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12974-025-03438-y

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12974-025-03438-y

Keywords

Journal of Neuroinflammation

ISSN: 1742-2094